The SafeFood4ClimDiet project, funded by the French National Research Agency (ANR) under the "Jeune Chercheur - Jeune Chercheuse (JCJC)" program, officially kicks off on January 15, 2025. This pioneering project investigates the effects of climate change on consumer eating habits and associated microbiological risks. Through interdisciplinary approaches, including sociological analysis, text-mining, and risk ranking, it aims to provide actionable recommendations to address current and future food safety challenges. The project emphasizes raising awareness among consumers and stakeholders about these critical issues. Stay tuned on our website for updates on SafeFood4ClimDiet!

This real-time RT-PCR is a molecular tool for detection of Foot-and-mouth disease virus lineage O/ME-SA/SA-2018, as it is an emerging lineage in South Asia since 2018. The assay has been tested on 34 FMDV positive samples (including 12 SA-2018 samples) with a specificity of 91,7% (11/12 SA-2018 samples detected). The primers and probes are indicated hereafter:  Oligo name (final concentration) Sequence (5’-3’) Use SA2018_F3 (0.4 μM) ACAACACCACCAATCCAAC Forward Primer SA2018_P3 (0.3 μM) FAM-ACTCACCCGACTTGCACTGCCGT-TAMRA Probe  SA2018_Rev2 (0.4 μM) CGTTGTAAACAGTAGCCATGA Reverse Primer The SA-2018 has been validated using Ag-Path kit in a duplex system with β-actin, and following the volumes and concentrations as follow (5 µl of RNA):    Volume (µl)  Concentration    For one tube  Initial  Final  Ultrapure water (DNase RNase Free)  1,15  /  Buffer 2X (kit AgPath-ID™)  12,5  2  1  X  Primer F  1  10  0,4  µM  Primer R  1  10  0,4  µM  Probe FAM-TAMRA  0,75  10  0,3  µM  Primer F β-actine  1  10  0,4  µM  Primer R β-actine  1  10  0,4  µM  Probe VIC-TAMRA β-actine  0,6  5  0,12  µM  RT-PCR mix 25X (Enzyme)  1  25  1  X  Real-time PCR program:  Cycles of RTq-PCR  T°  Time  nb cycles  45°C  10min  1  95°C  10min  1  95°C  15s  45  62°C  1min     NB: This system has been validated on a small number of samples and should therefore be tested against other samples from this lineage.     

An outbreak of Foot-and-Mouth Disease has been reported in Germany in water buffaloes. The outbreak is located in the Brandenburg region, close to Berlin (first reports of this disease in Germany since 1988). This is the first case in the EU since 2011 in Bulgaria. According to the regional authorities, three water buffaloes are confirmed as infected. Restriction zones have been set up around the outbreak. The identification of the serotype is pending. For more information: https://wahis.woah.org/#/in-review/6177 ; https://www.fli.de/en/news/short-messages/short-message/fli-confirms-foot-and-mouth-disease-in-brandenburg-water-buffalo/

December 2024 Newsletter to the attention of the NRLs for VMPR of Antimicrobials and Dyes in food from animal origin

June 3-6, 2025 Residues of pharmacologically active substances in food, feed and environment, within the One Health concept TRACES 2025 - TRACES

Method for the detection and confirmatory quantification of five nitrofuran metabolite residues in biological matrices using LC-MS/MS ANSES/LMV/19/01 - V5 of December 2024 And Method for the detection and quantification of residues of prohibited veterinary medicines in casings using LC-MS/MS F/CHIM/SM/PTC/036 - V1 of January 2025

We’re glad to inform you that the report of the inter-laboratory test evaluating the performance characteristics of the pan-lyssavirus real-time RT-PCR tests has just been released. We would like to warmly thank all the participants for their implication and their contribution in a better understanding of the available pan RT-PCR techniques, their variations and implications.   The report is available under restricted access here (onglet ILT reports).

The Centre is celebrating the publication of its eighth scientific article as a result of the work carried out in Activity 3 in 2023-2024.   The aim of this study was to assess the performance of latency-to-lie tests without the addition of water, making them more practical for use on farm.   This article named "Research Note: Testing the validity of latency-to-lie tests without water for objective on-farm assessment of walking ability of broiler chickens" has been published in Poultry Science and is available here.

EURCAW Aquatic Animals has their website up and running. Like the other EURCAWs, Aqua will be posting all of their publications, news and training on their website. To access the website, visit https://www.eurcaw-aqua.eu/