EURL
European Union Reference Laboratory for
Foot-and-Mouth disease
In response to the emergence of SAT1/III in the Middle East and European Union between 2025 and 2026, the following real-time RT-PCR assay (SAT1/III “BOT/1/77 like”) has been tested on few samples from this topotype. Data from EURL from FMD indicate that this assay is able to detect viruses from the SAT/III clade that is actually present in EU and Middle East. At this stage, this is a candidate assay that has not been extensively validated and further work is underway at the EURL and WRL for FMD.
The primers and probes are indicated hereafter:
|
Oligo name (final concentration) |
Sequence (5’-3’) |
Use |
Position (VP1) |
|
SAT1_III_2026_F (0.4 μM) |
ACTCTGGTTGGGAAGACTACTG |
Forward Primer |
118-139 |
|
SAT1_III_2026_P (0.3 μM) |
FAM-CATGGTTCTGGATCTTCTGAGCACCAA-TAMRA |
Probe |
147-173 |
|
SAT1_III_2026_R (0.4 μM) |
GGCGCCGACCAGTGACTT |
Reverse Primer |
178-195 |
The SAT1/III rtRT-PCR assay has been tested using Ag-Path kit in a duplex system with β-actin, and following the volumes and concentrations indicated in the methodology document that can be downloaded in the Methods section of the website.